Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
cTTN4 | |||
Gene | n/a | Organism | Human |
Genome Locus | chr2:179554540-179580501:n/a | Build | hg19 |
Disease | Heart failure | ICD-10 | Congestive heart failure (I50.0) |
DBLink | Link to database | PMID | 27531932 |
Experimental Method | |||
Sample Type | Heart Tissues | Comparison | left ventricles of 2 control, 2 HCM, and 2 DCM individuals, were used for whole transcriptome sequencing |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CCCAGAGGTGCCAAAGAAAC ReverseTGGAGACCCACCGATTTTG | Statistics | Fold Change : Upregulated,1.1700872946 pvalue : p=0.4785014539 |
Citation | |||
Khan, MA, Reckman, YJ, Aufiero, S, van den Hoogenhof, MM, van der Made, I, Beqqali, A, Koolbergen, DR, Rasmussen, TB, van der Velden, J, Creemers, EE, Pinto, YM (2016). RBM20 Regulates Circular RNA Production From the Titin Gene. Circ. Res., 119, 9:996-1003. |